SLC25A3 negatively regulates NLRP3 inflammasome activation by restricting the function of NLRP3.

The NACHT, leucine-rich repeat, and pyrin domains-containing protein 3 (collectively known as NLRP3) inflammasome activation plays a critical role in innate immune and pathogenic microorganism infections. However, excessive activation of NLRP3 inflammasome will lead to cellular inflammation and tissue damage, and naturally it must be precisely controlled in the host. Here, we discovered that solute carrier family 25 member 3 (SLC25A3), a mitochondrial phosphate carrier protein, plays an important role in negatively regulating NLRP3 inflammasome activation. We found that SLC25A3 could interact with NLRP3, overexpression of SLC25A3 and knockdown of SLC25A3 could regulate NLRP3 inflammasome activation, and the interaction of NLRP3 and SLC25A3 is significantly boosted in the mitochondria when the NLRP3 inflammasome is activated. Our detailed investigation demonstrated that the interaction between NLRP3 and SLC25A3 disrupted the interaction of NLRP3-NEK7, promoted ubiquitination of NLRP3, and negatively regulated NLRP3 inflammasome activation. Thus, these findings uncovered a new regulatory mechanism of NLRP3 inflammasome activation, which provides a new perspective for the therapy of NLRP3 inflammasome-associated inflammatory diseases.

Massage ameliorates lumbar disc herniation-related radicular pain in rats by suppressing TLR4/NLRP3 inflammasome signaling transduction.

BACKGROUND: Lumbar disc herniation (LDH) is a common spinal disease that can cause severe radicular pain. Massage, also known as Tuina in Chinese, has been indicated to exert an analgesic effect in patients with LDH. Nonetheless, the mechanism underlying this effect of massage on LDH remains unclarified. METHODS: Forty Sprague-Dawley rats were randomly divided into four groups. A rat LDH model was established by autologous nucleus pulpous (NP) implantation, followed by treatment with or without massage. A toll-like receptor 4 (TLR4) antagonist TAK-242 was administrated to rats for blocking TLR4. Behavioral tests were conducted to examine rat mechanical and thermal sensitivities. Western blotting was employed for determining TLR4 and NLRP3 inflammasome-associated protein levels in the spinal dorsal horn (SDH). Immunofluorescence staining was implemented for estimating the microglial marker Iba-1 expression in rat SDH tissue. RESULTS: NP implantation induced mechanical allodynia and thermal hyperalgesia in rat ipsilateral hindpaws and activated TLR4/NLRP3 inflammasome signaling transduction in the ipsilateral SDH. Massage therapy or TAK-242 administration relieved NP implantation-triggered pain behaviors in rats. Massage or TAK-242 hindered microglia activation and blocked TLR4/NLRP3 inflammasome activation in ipsilateral SDH of LDH rats. CONCLUSION: Massage ameliorates LDH-related radicular pain in rats by suppressing microglia activation and TLR4/NLRP3 inflammasome signaling transduction.

Repression of the SUMO-conjugating enzyme UBC9 is associated with lowered double minutes and reduced tumor progression.

Double minutes (DMs), extrachromosomal gene fragments found within certain tumors, have been noted to carry onco- and drug resistance genes contributing to tumor pathogenesis and progression. After screening for SUMO-related molecule expression within various tumor sample and cell line databases, we found that SUMO-conjugating enzyme UBC9 has been associated with genome instability and tumor cell DM counts, which was confirmed both in vitro and in vivo. Karyotyping determined DM counts post-UBC9 knockdown or SUMOylation inhibitor 2-D08, while RT-qPCR and Western blot were used to measure DM-carried gene expression in vitro. In vivo, fluorescence in situ hybridization (FISH) identified micronucleus (MN) expulsion. Western blot and immunofluorescence staining were then used to determine DNA damage extent, and a reporter plasmid system was constructed to detect changes in homologous recombination (HR) and non-homologous end joining (NHEJ) pathways. Our research has shown that UBC9 inhibition is able to attenuate DM formation and lower DM-carried gene expression, in turn reducing tumor growth and malignant phenotype, via MN efflux of DMs and lowering NHEJ activity to increase DNA damage. These findings thus reveal a relationship between heightened UBC9 activity, increased DM counts, and tumor progression, providing a potential approach for targeted therapies, via UBC9 inhibition.

Bioactive polyketides and meroterpenoids from the mangrove-derived fungus Talaromyces flavus TGGP35.

Six new polyketides, which includes three new lactones (talarotones A-C) (1-3), one new polyketide (talarotide A) (4), two new polyenes (talaroyenes A, B) (5, 6), together with one new meroterpenoid (talaropenoid A) (7) and 13 known compounds (8-20) were isolated from the mangrove-derived fungus Talaromyces flavus TGGP35. The structure and configuration of the compounds 1-7 were elucidated from the data obtained from HR-ESI-MS, IR, 1D/2D NMR spectroscopy, Mo2 (OAc)4-induced electronic circular dichroism (ECD), CD spectroscopy, and modified Mosher's method. Compounds 5 and 20 displayed antioxidant activity with IC50 values of 0.40 and 1.36 mM, respectively. Compounds 3, 6, 11, 16, and 17 displayed cytotoxic activity against human cancer cells Hela, A549, and had IC50 values ranging from 28.89 to 62.23 µM. Compounds 7, 10-12, and 14-18 exhibited moderate or potent anti-insect activity against newly hatched larvae of Helicoverpa armigera Hubner, with IC50 values in the range 50-200 µg/mL. Compound 18 showed antibacterial activity against Ralstonia solanacearum with the MIC value of 50 µg/mL.

Identification and characterization of the compound heterozygous variants of TYR gene in a northern Chinese family with Oculocutaneous albinism type 1.

Oculocutaneous albinism (OCA) is a genetically heterogeneous disease and is most inherited in an autosomal recessive manner. The characteristic manifestation of OCA is due to disfunction of melanin synthesis. OCA1 is the most severe subtype of OCA and is caused by homozygous or compound heterozygous variants in tyrosinase (TYR) gene, which is the key gene for melanin synthesis. This study aimed to identify the genetic variants of a northern Chinese family with OCA1. Clinical information and peripheral blood samples were collected. PCR amplification and Sanger sequencing were used to detect the entire exons and adjacent flanking sequences of TYR gene. Functional prediction of variants was performed by various bioinformatic analyses, while the pathogenicity classification of variants was evaluated according to ACMG standards and guidelines. A missense variant NM_000372.5:c.107G > C;NP_000363.1:p.C36S was discovered in TYR gene which converted cysteine to serine. Another variant in intron, NM_000372.5:c.1037-7 T > A, also affected the function of TYR gene. We verified the pathogenicity of the intron variant with a pCAS2 mini-gene based splicing assay and found that c.1037-7 T > A led to an insertion of 5 bp upstream from the common acceptor site of exon 3, which caused a frameshift TYR:c.1037-7 T > A:p.G346Efs*11. The results showed that the compound heterozygous variants c.107G > C:p.C36S and c.1037-7 T > A:p.G346Efs*11 of TYR gene were the pathogenic variants for this OCA1 family.

Biomedical association analysis between G2/M checkpoint genes and susceptibility to HIV-1 infection and AIDS progression from a northern chinese MSM population.

BACKGROUND: MSM are at high risk of HIV infection. Previous studies have shown that the cell cycle regulation plays an important role in HIV-1 infection, especially at the G2/M checkpoint. ATR, Chk1, Cdc25C and CDK1 are key genes of G2/M checkpoint. However, the association between SNPs of these genes and susceptibility to HIV-1 infection and AIDS progression remains unknown. METHODS: In this study, 42 tSNPs from the above four G2/M checkpoint genes were genotyped in 529 MSM and 529 control subjects from northern China to analyze this association. RESULTS: The results showed that rs34660854 A and rs75368165 A in ATR gene and rs3756766 A in Cdc25C gene could increase the risk of HIV-1 infection (P = 0.049, OR = 1.234, 95% CI 1.001-1.521; P = 0.020, OR = 1.296, 95% CI 1.042-1.611; P = 0.011, OR = 1.392, 95% CI 1.080-1.794, respectively), while Chk1 rs10893405 (P = 0.029, OR = 1.629, 95% CI 1.051-2.523) were significantly associated with AIDS progression. Besides, rs34660854 (P = 0.019, OR = 1.364, 95% CI 1.052-1.769; P = 0.022, OR = 1.337, 95% CI 1.042-1.716, under Codominant model and Dominant model, respectively) and rs75368165 (P = 0.006, OR = 1.445, 95% CI = 1.114-1.899; P = 0.007, OR = 1.418, 95% CI 1.099-1.831, under Codominant model and Dominant model, respectively) in ATR gene, rs12576279 (P = 0.013, OR = 0.343, 95% CI 0.147-0.800; P = 0.048, OR = 0.437, 95% CI 0.192-0.991, under Codominant model and Dominant model, respectively) and rs540436 (P = 0.012, OR = 1.407, 95% CI 1.077-1.836; P = 0.021, OR = 1.359, 95% CI 1.048-1.762, under Codominant model and Dominant model, respectively) in Chk1 gene, rs3756766 (P = 0.013, OR = 1.455, 95% CI 1.083-1.954; P = 0.009, OR = 1.460, 95% CI 1.098-1.940, under Codominant model and Dominant model, respectively) in Cdc25C gene and rs139245206 (P = 0.022, OR = 5.011, 95% CI 1.267-19.816; P = 0.020, OR = 5.067, 95% CI 1.286-19.970, under Codominant model and Recessive model, respectively) in CDK1 gene were significantly associated with HIV-1 infection under different models. CONCLUSIONS: We found that genetic variants of G2/M checkpoint genes had a molecular influence on the occurrence of HIV-1 infection and AIDS progression in a northern Chinese MSM population.

Modeling Osteoarthritis: MiR-16-5p Attenuates IL-1ß Induced Chondrocyte Dysfunction by Targeting MAP2K1 through the MAPK Pathway.

OBJECTIVE: Osteoarthritis (OA) is a chronic joint disease characterized by cartilage degeneration, significantly reducing the quality of life. Previous report has confirmed that MAP2K1 acts as a potential therapeutic target in OA. Nevertheless, its specific function and related molecular mechanism in OA remain uncharacterized. Our report revealed the biological significance of MAP2K1 and elucidated its regulatory mechanism in OA. METHODS: Interleukin (IL)-1ß was utilized to stimulate human chondrocyte cell line CHON-001 for establishing the in vitro models of OA. Cell apoptosis and viability were determined by flow cytometry analysis and CCK-8 assay. Protein levels and gene expression were quantified by western blotting and RT-qPCR. Binding relation between miR-16-5p and MAP2K1 (mitogen-activated protein kinase kinase 1) was confirmed by luciferase reporter assay. RESULTS: IL-1ß treatment triggered CHON-001 cell injury by repressing cell viability and facilitating cell apoptosis. Moreover, IL-1ß stimulation upregulated MAP2K1 level in CHON-001 cells. MAP2K1 depletion attenuated IL-1ß-elicited CHON-001 cell injury. Mechanistically, miR-16-5p targeted MAP2K1 in CHON-001 cells. In rescue assays, MAP2K1 upregulation counteracted the suppressive impact of miR-16-5p enhancement on IL-1ß-triggered CHON-001 cell dysfunction. In addition, upregulated miR-16-5p suppressed IL-1ß-elicited activation of MAPK pathway in CHON-001 cells. CONCLUSIONS: MiR-16-5p mitigates IL-1ß-induced damage to chondrocyte CHON-001 by targeting MAP2K1 and inactivating the MAPK signaling.

Rational design of bimetallic MXene solid solution with High-Performance electrocatalytic N2 reduction.

Electrocatalytic N2 reduction reaction (eNRR) was an effective alternative method for green synthesis of NH3. By combining the first-principal Density functional theory (DFT) calculations and Monte Carlo (MC) simulation, we systematacially investigated 24 types equal-ratio bimetallic MXene solid solution, involving 88 different catalysts. Our focus was on the catalytic performance of these materials in eNRR. The computational result indicate that MoW(3Mo) has high stability, selectivity (93.8 % against the hydrogen evolution reaction (HER)) and activity (UL = -0.26 V), which is significantly better than that of monometal Mo2CO2 and W2CO2. This improvement in catalytic properties is attributed to the unique electronic structure (e.g. d-band center, charge) of bimetallic MXene solid solution. In explicit solvent conditions, the microenvironment of hydrogen bond in aqueous liquid thermodynamically promotes the catalytic property for eNRR and reduce the catalytic property of HER side reaction, but the kinetic barrier is also increased due to the effect of the hydrogen-bond microenvironment on proton migration. Overall, the obtained bimetallic MXene solid solution MoW(3Mo) exhibits excellent catalytic performance in eNRR.

Bioactive secondary metabolites from tomato-derived bacterium Bacillus velezensis Hnu24.

A series of secondary metabolites have been isolated from the genus of Bacillus velezensis, most of which show antibacterial and insecticidal activities. In order to find more bioactive secondary metabolites from B. velezensis, one new natural component aminoindole dimer baciindole A (1), together with seven known compounds (2-8) were isolated from the tomato-derived bacterium Bacillus velezensis Hnu24. The structure of compound 1 was elucidated by its HR-ESI-MS spectral data and 1 D/2D NMR spectroscopic analysis. Compound 3 showed antibacterial activity against Staphylococcus aureus, S. epidermidis and Ralstonia solanacearum with the MIC values of 3.125, 12.5 and 50 µg/mL, respectively. Compound 4 showed antibacterial activity against S. aureus with the MIC value of 12.5 µg/mL. Compound 3 showed cytotoxic activity for human colon cancer HTC116 cancer cells with the IC50 value of 8.42 ± 0.48 µM. Five compounds (1-4 and 8) were obtained from the strain of B. velezensis for the first time. These results indicated that 3 will be useful in developing antimicrobial and treatment of colon cancer agents.

Regulation and functions of the NLRP3 inflammasome in RNA virus infection.

Virus infection is one of the greatest threats to human life and health. In response to viral infection, the host's innate immune system triggers an antiviral immune response mostly mediated by inflammatory processes. Among the many pathways involved, the nucleotide-binding oligomerization domain (NOD)-like receptor protein 3 (NLRP3) inflammasome has received wide attention in the context of viral infection. The NLRP3 inflammasome is an intracellular sensor composed of three components, including the innate immune receptor NLRP3, adaptor apoptosis-associated speck-like protein containing CARD (ASC), and the cysteine protease caspase-1. After being assembled, the NLRP3 inflammasome can trigger caspase-1 to induce gasdermin D (GSDMD)-dependent pyroptosis, promoting the maturation and secretion of proinflammatory cytokines such as interleukin-1 (IL-1ß) and interleukin-18 (IL-18). Recent studies have revealed that a variety of viruses activate or inhibit the NLRP3 inflammasome via viral particles, proteins, and nucleic acids. In this review, we present a variety of regulatory mechanisms and functions of the NLRP3 inflammasome upon RNA viral infection and demonstrate multiple therapeutic strategies that target the NLRP3 inflammasome for anti-inflammatory effects in viral infection.

The effect of SNPs in lncRNA as ceRNA on the risk and prognosis of hepatocellular carcinoma.

BACKGROUND: Most susceptible loci of hepatocellular carcinoma (HCC) identified by genome-wide association studies (GWAS) are located in non-coding regions, and the mechanism of action remains unclear. The objective of this study was to explore the association of single nucleotide polymorphisms (SNPs) on long non-coding RNAs (lncRNAs) that affect competing endogenous RNAs (ceRNA) regulation mechanism with the risk and prognosis of HCC. METHODS: Based on a set of bioinformatics strategies, eight lncRNA genes that affect HCC through the mechanism of lncRNA-mediated ceRNA were systematically screened, and 15 SNPs that affect microRNA (miRNA) binding in these lncRNA genes were annotated. Genotyping was performed in 800 HCC cases and 801 healthy controls to examine associations of these SNPs with HCC in a northeastern Chinese Han population. RESULTS: The GG, GC and GG + GC genotypes of HOTAIR rs7958904 were associated with a 0.65, 0.59 and 0.63-fold decreased HCC risk, respectively. In addition, HCC patients with PVT1 rs3931282 AA + GA genotypes were less prone to develop late-stage cancers in a stratified analysis of clinical characteristics. When stratified by clinical biochemical indexes, rs1134492 and rs10589312 in PVT1 and rs84557 in EGFR-AS1 showed significant associations with aspartate aminotransferase (AST), alanine aminotransferase (ALT) or AST/ALT ratio in HCC patients. Furthermore, we constructed potential ceRNA regulatory axes that might be affected by five positive SNPs to explain the causes of these genetic associations. CONCLUSIONS: HOTAIR rs7958904, PVT1 rs3931282, rs1134492 and rs10589312, and EGFR-AS1 rs84557 might be predictors for HCC risk or prognosis. Our results provide new insights into how SNPs on lncRNA-mediated ceRNAs confer interindividual differences to occurrence and progression of HCC.

Association of Polymorphisms in NHEJ Pathway Genes with HIV-1 Infection and AIDS Progression in a Northern Chinese MSM Population.

Background and Aims: Men who have sex with men (MSM) are at high risk of HIV infection. The nonhomologous end joining (NHEJ) pathway is the main way of double-stranded DNA break (DSB) repair in the higher eukaryotes and can repair the DSB timely at any time in cell cycle. It is also indicated that the NHEJ pathway is associated with HIV-1 infection since the DSB in host genome DNA occurs in the process of HIV-1 integration. The aim of the present investigation was to evaluate associations of single-nucleotide polymorphisms (SNPs) in NHEJ pathway genes with susceptibility to HIV-1 infection and AIDS progression among MSM residing in northern China. Methods: A total of 481 HIV-1 seropositive men and 493 HIV-1 seronegative men were included in this case-control study. Genotyping of 22 SNPs in NHEJ pathway genes was performed using the SNPscan™ Kit. Results: Positive associations were observed between XRCC6 rs132770 and XRCC4 rs1056503 genotypes and the susceptibility to HIV-1 infection. In gene-gene interaction analysis, significant SNP-SNP interactions of XRCC6 and XRCC4 genetic variations were found to play a potential role in the risk of HIV-1 infection. In stratified analysis, XRCC5 rs16855458 was significantly associated with CD4+ T cell counts in AIDS patients, whereas LIG4 rs1805388 was linked to the clinical phases of AIDS patients. Conclusions: NHEJ gene polymorphisms can be considered to be risk factors of HIV-1 infection and AIDS progression in the northern Chinese MSM population.

A novel variant of GLI3, p.Asp1514Thrfs*5, is identified in a Chinese family affected by polydactyly.

BACKGROUND: Polydactyly is a common congenital malformation characterized by the presence of supernumerary fingers or toes. In this case study, we sought to identify the causative pathogenic factor in a family from a northern region of China affected by non-syndromic postaxial polydactyly (PAP). METHODS: After recruiting a three-generation family with PAP, whole-exome sequencing was performed to identify the causative variant. In silico analysis and Sanger sequencing were used to validate the variant. RESULTS: We identified a novel heterozygous frameshift variant (NM_000168.6:c.4540delG, p.Asp1514Thrfs*5) in the transcriptional activator (TA1) domain of the GLI3 gene. CONCLUSION: The novel frameshift variant identified in this study further confirms the relationship between non-syndromic PAP and GLI3 and extends the previously established mutational and phenotypic spectra of GLI3.

Association of APEX1 and XRCC1 Gene Polymorphisms With HIV-1 Infection Susceptibility and AIDS Progression in a Northern Chinese MSM Population.

Background: Some studies have shown that the base excision repair (BER) pathway has an effect on HIV-1 replication. APEX1 and XRCC1 as key BER genes may affect DNA repair capacity. However, the roles of single nucleotide polymorphisms (SNPs) in APEX1 and XRCC1 and their impact on HIV-1 infection and AIDS progression remain unclear. Methods: A custom-designed 48-Plex SNPscan Kit was used for detection of single nucleotide polymorphisms. 601 HIV-1-infected men who have sex with men (MSM) and 624 age-matched healthy individuals were recruited in northern China. Four SNPs (rs1130409, rs1760944, rs2307486 and rs3136817) in APEX1 gene and three SNPs (rs1001581, rs25487 and rs25489) in XRCC1 gene were genotyped. The generalized multifactor dimension reduction (GMDR) method was used to identify the SNP-SNP interactions. Results: In this study, rs1130409 G allele, rs1001581 C allele and rs25487 C allele were associated with a higher risk of HIV-1 infection susceptibility (p = 0.020, p = 0.007 and p = 0.032, respectively). The frequencies of APEX1 haplotype TT and XRCC1 haplotype CT showed significant differences between cases and controls (p = 0.0372 and p = 0.0189, respectively). Interestingly, stratified analysis showed that the frequency of rs1001581 C allele was significantly higher in AIDS patients with the CD4+ T-lymphocyte count <200 cells/µl than those with >200 cells/µl (p = 0.022). Moreover, significant gene-gene interactions among rs1130409, rs1001581 and rs25487 were identified by GMDR (p = 0.0107). Specially, individuals with five to six risk alleles have a higher susceptibility to HIV-1 infection than those with zero to two risk alleles (p < 0.001). Conclusion: APEX1 and XRCC1 gene polymorphisms were associated with the susceptibility to HIV-1 infection and AIDS progression in MSM populations in northern China.

Association Between Nonsyndromic Cleft Lip and Palate and 2 Polymorphic Loci: A Meta-Analysis.

OBJECTIVES: The relationship between Noggin (NOG) and methylenetetrahydrofolate reductase and nonsyndromic cleft lip and palate (NSCLP) has been reported participate in craniofacial development but need further evidence. To indicate the susceptibility between the 2 genes and NSCLP, rs227731 and rs1801131 polymorphisms were included in the present research. This research may provide some genetic clues for disease detection and surveillance. DESIGN: Seventeen studies including 4023 cases and 5691 controls were provided for meta-analysis, and odds ratio (OR) with 95% CI were obtained to estimate NSCLP risk. RESULTS: Our analysis suggested potential association of rs227731C on increasing the risk of NSCLP in the Caucasian group and total group but not Asian group under all models: allele (OR = 1.45, 95% CI = 1.21-1.75, P < .0001), homozygote (OR = 2.03, 95% CI = 1.42-2.90, P < .0001), heterozygote (OR = 1.44, 95% CI = 1.19-1.73, P = .0001), dominant (OR = 1.61, 95% CI = 1.27-2.04, P < .0001), and recessive models (OR = 1.63, 95% CI = 1.25-2.12, P = .0003). Besides, increased risk is related to rs1801131 in Asian group under 3 models: allele (OR = 1.24, 95% CI = 1.06-1.44, P = .006), heterozygote (OR = 1.24, 95% CI = 1.02-1.52, P = .03), and dominant models (OR = 1.29, 95% CI = 1.06-1.56, P = .009). CONCLUSIONS: Our analysis indicates polymorphisms rs227731 and rs1801131 are associated with NSCLP, with predominance of different ethnic group and deepen understanding of NSCLP.

Disease causing property analyzation of variants in 12 Chinese families with polycystic kidney disease.

BACKGROUND: Polycystic kidney disease (PKD) is an inherited disease that is life-threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. METHODS: This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. RESULTS: Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. CONCLUSION: The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family.

Pulsed Laser Ablation in Water Synthesis of Black TiO2-Graphene Oxide Nanocomposites and the Enhanced Photocatalytic Performance.

Black TiO2-graphene oxide (GO) nanocomposites are synthesized via the pulsed laser ablating TiO2 powders and GO in deionized water. The simple process enables the preparation of black TiO2 nanoparticles and anchors them onto the GO sheet in one step. The TiO2-GO nanocomposites exhibit greatly enhancement for photocatalytic degradation of Rhodamine B (RB) dye in comparison with the pristine and the ablated black TiO2. The heterojunction structure plays an important role in efficient charge separation, which reduces the recombination of photogenerated electrons and holes. The unique two-dimensional structure of GO enables the composite to have a large specific surface area, and prevents the agglomeration of TiO2 nanoparticles, which are beneficial to the photocatalytic performance of the composite.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Association between polymorphisms in MRE11 and HIV-1 susceptibility and AIDS progression in a northern Chinese MSM population.

BACKGROUND: Previous studies reported that DNA damage repair (DDR) genes may play an important role in HIV-1 infection. The MRE11 gene, a member of the MRN complex, plays an essential part in the homologous recombination pathway, which is one of the classical DDR pathways. Previous reports have demonstrated that MRE11 has an effect on HIV-1 replication. However, the role of SNPs in the MRE11 gene and their impact on HIV-1 infection and AIDS progression remain unknown. METHODS: In this study, 434 MSM HIV-1-infected patients in northern China and 431 age-matched healthy controls were enrolled. Five SNPs (rs2155209, rs10831234, rs13447720, rs601341 and rs11020803) at the MRE11 gene were genotyped. Another series of cases (409 MSM HIV-1-infected patients) and controls (403 age-matched healthy males) were recruited as the validation set. RESULTS: In our study, rs10831234 showed differences in allele frequencies between cases and controls (P = 0.005). Additionally, there was an association between rs10831234 and HIV-1 infection susceptibility in dominant and additive models (P = 0.005 and P = 0.006, respectively). All significant associations were replicated in the validation set, and the associations were still significant after Bonferroni correction for multiple testing when the two data sets were combined. Furthermore, in haplotype association analyses between the case and control groups, the frequencies of the haplotypes Crs11020803Crs10831234 and Trs11020803Trs10831234 showed significant differences (P = 0.0181 and P = 0.0068, respectively). CONCLUSIONS: We demonstrated that the MRE11 rs10831234-T allele may confer increased risk of HIV-1 infection.

Identification of a pathogenic mutation in a Chinese pedigree with polycystic kidney disease.

Polycystic kidney disease (PKD) is a life­threatening inherited disease with a morbidity of 1:500­1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin­1, lipoxygenase, α­toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N­terminal domain of polycystin­1 may present high pathogenicity in ADPKD.